ID: 900310259_900310271

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 900310259 900310271
Species Human (GRCh38) Human (GRCh38)
Location 1:2030047-2030069 1:2030077-2030099
Sequence CCATCTCCCGCCGGCAGCGCCGC GGAACCTGATGGGCTCCTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 261} {0: 1, 1: 0, 2: 0, 3: 2, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!