ID: 900330676_900330680

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 900330676 900330680
Species Human (GRCh38) Human (GRCh38)
Location 1:2133056-2133078 1:2133073-2133095
Sequence CCTGCTGGAGGCTCCCTGATGAG GATGAGCCCTGGCGTCTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 174} {0: 1, 1: 0, 2: 0, 3: 6, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!