ID: 900447655_900447660

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 900447655 900447660
Species Human (GRCh38) Human (GRCh38)
Location 1:2689450-2689472 1:2689480-2689502
Sequence CCTCACCTCCAGGTGAGCATCGG GGAGCAGCGCCCACACCCCCAGG
Strand - +
Off-target summary {0: 8, 1: 42, 2: 317, 3: 544, 4: 534} {0: 40, 1: 181, 2: 365, 3: 431, 4: 509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!