|
Left Crispr |
Right Crispr |
| Crispr ID |
900447658 |
900447667 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:2689458-2689480
|
1:2689499-2689521
|
| Sequence |
CCAGGTGAGCATCGGAGAGTCTG |
CAGGCGAGCATCTGACAGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 0, 2: 37, 3: 389, 4: 614} |
{0: 106, 1: 411, 2: 547, 3: 339, 4: 348} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|