ID: 900646509_900646511

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 900646509 900646511
Species Human (GRCh38) Human (GRCh38)
Location 1:3711207-3711229 1:3711231-3711253
Sequence CCTGGGGAGCGCTCCACACACGT AGCTCTGAGTGCAGTGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64} {0: 1, 1: 2, 2: 2, 3: 21, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!