ID: 900653251_900653261

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 900653251 900653261
Species Human (GRCh38) Human (GRCh38)
Location 1:3741732-3741754 1:3741781-3741803
Sequence CCTGTGCTCTGGAGAGCTCAGAG TCTTACAGGGAAGAGATTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 314} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!