ID: 900737654_900737661

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 900737654 900737661
Species Human (GRCh38) Human (GRCh38)
Location 1:4309177-4309199 1:4309224-4309246
Sequence CCCCTGGCCACCTGTGGCAATGT ATGAGTTCATGTCCTTTGTAGGG
Strand - +
Off-target summary No data {0: 16138, 1: 11559, 2: 7091, 3: 4106, 4: 2672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!