ID: 900835299_900835310

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 900835299 900835310
Species Human (GRCh38) Human (GRCh38)
Location 1:4998715-4998737 1:4998761-4998783
Sequence CCTGACTTCAGGCCCACAGAACA TCACTGAAGCCCACTGGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 25, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!