ID: 900835300_900835312

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 900835300 900835312
Species Human (GRCh38) Human (GRCh38)
Location 1:4998727-4998749 1:4998763-4998785
Sequence CCCACAGAACACCTCGAACTTCC ACTGAAGCCCACTGGGATGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!