ID: 900879473_900879475

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 900879473 900879475
Species Human (GRCh38) Human (GRCh38)
Location 1:5370334-5370356 1:5370364-5370386
Sequence CCCAAAAGTTGGTTTGATTATTT CTGAATATGCAAACAAACAATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 11, 3: 79, 4: 512}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!