ID: 901055580_901055584

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 901055580 901055584
Species Human (GRCh38) Human (GRCh38)
Location 1:6447426-6447448 1:6447443-6447465
Sequence CCTGCGGTGTCGCATTTCCTGCA CCTGCAACGTGAGCCAGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 5, 4: 54} {0: 3, 1: 0, 2: 0, 3: 6, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!