ID: 901361360_901361372

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 901361360 901361372
Species Human (GRCh38) Human (GRCh38)
Location 1:8703406-8703428 1:8703448-8703470
Sequence CCCAGACGCCGGGAGAGAAAGAG GCGGCCGGCAAAACCCGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 145} {0: 1, 1: 0, 2: 2, 3: 10, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!