ID: 901443518_901443529

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 901443518 901443529
Species Human (GRCh38) Human (GRCh38)
Location 1:9293265-9293287 1:9293287-9293309
Sequence CCGGGGGCGCCTCCCTCGCCGCG GGCTCCTGGGAGAGGGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 267} {0: 1, 1: 0, 2: 6, 3: 92, 4: 662}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!