ID: 901512549_901512559

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 901512549 901512559
Species Human (GRCh38) Human (GRCh38)
Location 1:9724683-9724705 1:9724707-9724729
Sequence CCACCCATTATCAGGGCAAGGGC GGTGTCCTTGGGGAAGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 87} {0: 1, 1: 0, 2: 2, 3: 66, 4: 629}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!