ID: 901532671_901532677

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 901532671 901532677
Species Human (GRCh38) Human (GRCh38)
Location 1:9863465-9863487 1:9863478-9863500
Sequence CCCAGAAACCCCAGCAGATCATC GCAGATCATCCGTGTGGCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 152} {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!