ID: 901783930_901783946

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 901783930 901783946
Species Human (GRCh38) Human (GRCh38)
Location 1:11612168-11612190 1:11612221-11612243
Sequence CCTGTGAGCACAGAGGAGAGAGA TAAGGGAAAGGGGTAGGGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 45, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!