ID: 901847584_901847590

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 901847584 901847590
Species Human (GRCh38) Human (GRCh38)
Location 1:11993618-11993640 1:11993644-11993666
Sequence CCAGCTACTTGGGAGGCTAGGGC AGAATGGTGTGAACCCCAGGGGG
Strand - +
Off-target summary {0: 73, 1: 3837, 2: 91471, 3: 202528, 4: 245534} {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!