ID: 901887003_901887011

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 901887003 901887011
Species Human (GRCh38) Human (GRCh38)
Location 1:12230266-12230288 1:12230287-12230309
Sequence CCCGTCGTCCGGCCTCGGTCTGA GAGCCCCTCGGGGTAACCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 38} {0: 1, 1: 0, 2: 2, 3: 6, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!