ID: 901887009_901887024

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 901887009 901887024
Species Human (GRCh38) Human (GRCh38)
Location 1:12230278-12230300 1:12230325-12230347
Sequence CCTCGGTCTGAGCCCCTCGGGGT GGCCCCAAGCCCGCCACCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154} {0: 1, 1: 0, 2: 1, 3: 17, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!