ID: 901887013_901887027

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 901887013 901887027
Species Human (GRCh38) Human (GRCh38)
Location 1:12230291-12230313 1:12230327-12230349
Sequence CCCTCGGGGTAACCCTGGGCGTC CCCCAAGCCCGCCACCTCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44} {0: 1, 1: 0, 2: 0, 3: 24, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!