ID: 901940003_901940011

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 901940003 901940011
Species Human (GRCh38) Human (GRCh38)
Location 1:12654810-12654832 1:12654840-12654862
Sequence CCTAAGACTAACCTTTGATCATT AAGACGGCCCTCTCCGGGGTAGG
Strand - +
Off-target summary {0: 3, 1: 28, 2: 44, 3: 102, 4: 254} {0: 1, 1: 0, 2: 1, 3: 12, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!