ID: 902004863_902004873

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 902004863 902004873
Species Human (GRCh38) Human (GRCh38)
Location 1:13224187-13224209 1:13224233-13224255
Sequence CCACAGGAGCCCAGTGGAAGAGA AGGTCTAGGGACATCAGCTAGGG
Strand - +
Off-target summary No data {0: 10, 1: 2, 2: 4, 3: 5, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!