ID: 902024081_902024090

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 902024081 902024090
Species Human (GRCh38) Human (GRCh38)
Location 1:13369922-13369944 1:13369967-13369989
Sequence CCACAGGAGCCCAGTGGAAGAGA AAGGTCTAGGGACATCAGCTAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 34, 4: 301} {0: 10, 1: 5, 2: 1, 3: 10, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!