ID: 902051272_902051278

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 902051272 902051278
Species Human (GRCh38) Human (GRCh38)
Location 1:13565359-13565381 1:13565401-13565423
Sequence CCACCTCTATACTGTCCAATAAA AATCACCCAAGCAGTTTCTCAGG
Strand - +
Off-target summary No data {0: 157, 1: 81, 2: 384, 3: 197, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!