ID: 902100775_902100780

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 902100775 902100780
Species Human (GRCh38) Human (GRCh38)
Location 1:13986795-13986817 1:13986813-13986835
Sequence CCGGGGCCCTCGTGTCTAGACAG GACAGCAGTGCCAGGACATTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 14, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!