ID: 902479419_902479425

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 902479419 902479425
Species Human (GRCh38) Human (GRCh38)
Location 1:16703918-16703940 1:16703931-16703953
Sequence CCCTCTTCCTCCTGGGCACACTC GGGCACACTCACCACGTGGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 5, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!