ID: 902479419_902479428

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 902479419 902479428
Species Human (GRCh38) Human (GRCh38)
Location 1:16703918-16703940 1:16703950-16703972
Sequence CCCTCTTCCTCCTGGGCACACTC AGGGTGCTGGCCCTTGATGCTGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 4, 3: 41, 4: 527} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!