ID: 902594336_902594342

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 902594336 902594342
Species Human (GRCh38) Human (GRCh38)
Location 1:17498055-17498077 1:17498078-17498100
Sequence CCCAGCCTAATGACTACTTTCCC TCTGGATAGATACCCAGTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!