ID: 902711742_902711756

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 902711742 902711756
Species Human (GRCh38) Human (GRCh38)
Location 1:18244629-18244651 1:18244678-18244700
Sequence CCCTCTGTGTCTCAGGCCTGGTG CCTGGTGGAATAAAGGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 416} {0: 1, 1: 0, 2: 3, 3: 15, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!