ID: 902711745_902711756

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 902711745 902711756
Species Human (GRCh38) Human (GRCh38)
Location 1:18244645-18244667 1:18244678-18244700
Sequence CCTGGTGCTGGATGCTGCCACAG CCTGGTGGAATAAAGGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 300} {0: 1, 1: 0, 2: 3, 3: 15, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!