ID: 902890233_902890238

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 902890233 902890238
Species Human (GRCh38) Human (GRCh38)
Location 1:19438046-19438068 1:19438072-19438094
Sequence CCATCCATCCAAGTATTGTTCTT TCCCACTACCTCCTACGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 237} {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!