ID: 902929467_902929470

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 902929467 902929470
Species Human (GRCh38) Human (GRCh38)
Location 1:19720519-19720541 1:19720558-19720580
Sequence CCTATTTGTTTTTCTCTGGGTCC CCCATAAGTTGTTGCTTTAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 341} {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!