|
Left Crispr |
Right Crispr |
| Crispr ID |
902931735 |
902931745 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:19736314-19736336
|
1:19736340-19736362
|
| Sequence |
CCCCCTGATTCAATTACCTCCCA |
GGTCCCTCCCATGACCCATGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 28, 1: 3156, 2: 6514, 3: 9422, 4: 10877} |
{0: 8, 1: 398, 2: 1030, 3: 2122, 4: 3341} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|