|
Left Crispr |
Right Crispr |
| Crispr ID |
902931737 |
902931751 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:19736316-19736338
|
1:19736348-19736370
|
| Sequence |
CCCTGATTCAATTACCTCCCACC |
CCATGACCCATGTGGATTGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1659, 1: 4879, 2: 8898, 3: 10570, 4: 9952} |
{0: 1, 1: 0, 2: 50, 3: 725, 4: 1772} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|