ID: 902931738_902931745

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 902931738 902931745
Species Human (GRCh38) Human (GRCh38)
Location 1:19736317-19736339 1:19736340-19736362
Sequence CCTGATTCAATTACCTCCCACCG GGTCCCTCCCATGACCCATGTGG
Strand - +
Off-target summary {0: 7, 1: 50, 2: 109, 3: 187, 4: 277} {0: 8, 1: 398, 2: 1030, 3: 2122, 4: 3341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!