|
Left Crispr |
Right Crispr |
| Crispr ID |
902931742 |
902931757 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:19736333-19736355
|
1:19736379-19736401
|
| Sequence |
CCCACCGGGTCCCTCCCATGACC |
TTCAAGATGAGATTTGGGTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 142, 2: 1374, 3: 3264, 4: 6447} |
{0: 7463, 1: 11190, 2: 9643, 3: 7118, 4: 4722} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|