|
Left Crispr |
Right Crispr |
| Crispr ID |
902931743 |
902931755 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:19736334-19736356
|
1:19736373-19736395
|
| Sequence |
CCACCGGGTCCCTCCCATGACCC |
CCACAATTCAAGATGAGATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 85, 2: 895, 3: 2636, 4: 6231} |
{0: 106, 1: 4288, 2: 7611, 3: 10206, 4: 11650} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|