ID: 902931746_902931755

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 902931746 902931755
Species Human (GRCh38) Human (GRCh38)
Location 1:19736343-19736365 1:19736373-19736395
Sequence CCCTCCCATGACCCATGTGGATT CCACAATTCAAGATGAGATTTGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 554, 3: 1485, 4: 3368} {0: 106, 1: 4288, 2: 7611, 3: 10206, 4: 11650}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!