|
Left Crispr |
Right Crispr |
Crispr ID |
902931746 |
902931755 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:19736343-19736365
|
1:19736373-19736395
|
Sequence |
CCCTCCCATGACCCATGTGGATT |
CCACAATTCAAGATGAGATTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 16, 2: 554, 3: 1485, 4: 3368} |
{0: 106, 1: 4288, 2: 7611, 3: 10206, 4: 11650} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|