ID: 902956402_902956405

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 902956402 902956405
Species Human (GRCh38) Human (GRCh38)
Location 1:19926854-19926876 1:19926892-19926914
Sequence CCTTCTAAACAACTGAAAATTAG CCTGTAGAGTACCTGAAGTCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 32, 4: 356} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!