|
Left Crispr |
Right Crispr |
| Crispr ID |
902974473 |
902974479 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:20078966-20078988
|
1:20078999-20079021
|
| Sequence |
CCAGGCATGGTGGTGCCCACTGT |
ACTCGAGAGGCAGAGGCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 7, 2: 76, 3: 635, 4: 5041} |
{0: 3, 1: 212, 2: 3761, 3: 18251, 4: 40555} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|