ID: 902974475_902974478

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 902974475 902974478
Species Human (GRCh38) Human (GRCh38)
Location 1:20078982-20079004 1:20078996-20079018
Sequence CCACTGTAGTCTCAGCTACTCGA GCTACTCGAGAGGCAGAGGCAGG
Strand - +
Off-target summary {0: 3, 1: 49, 2: 800, 3: 2267, 4: 3280} {0: 16, 1: 3666, 2: 103830, 3: 252114, 4: 200476}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!