ID: 902974475_902974481

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 902974475 902974481
Species Human (GRCh38) Human (GRCh38)
Location 1:20078982-20079004 1:20079007-20079029
Sequence CCACTGTAGTCTCAGCTACTCGA GGCAGAGGCAGGAGGGAAGATGG
Strand - +
Off-target summary {0: 3, 1: 49, 2: 800, 3: 2267, 4: 3280} {0: 1, 1: 0, 2: 35, 3: 334, 4: 2259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!