|
Left Crispr |
Right Crispr |
| Crispr ID |
902974475 |
902974485 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:20078982-20079004
|
1:20079028-20079050
|
| Sequence |
CCACTGTAGTCTCAGCTACTCGA |
GGCTTGAGCCCAGGAGGTGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 49, 2: 800, 3: 2267, 4: 3280} |
{0: 182, 1: 2379, 2: 23160, 3: 72774, 4: 142918} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|