|
Left Crispr |
Right Crispr |
| Crispr ID |
903104319 |
903104325 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:21062149-21062171
|
1:21062199-21062221
|
| Sequence |
CCAGGGCTCAAGCAATCCTCTCG |
CATGTGTGTGCCACTACACTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 112, 1: 2344, 2: 18419, 3: 54972, 4: 138844} |
{0: 1, 1: 20, 2: 385, 3: 4073, 4: 24334} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|