ID: 903117830_903117834

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 903117830 903117834
Species Human (GRCh38) Human (GRCh38)
Location 1:21192678-21192700 1:21192700-21192722
Sequence CCTTCCTCACTCTCCTGCTGCCA ATTCTGCCCCCTCCCCACTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 7, 3: 38, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!