ID: 903164386_903164396

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 903164386 903164396
Species Human (GRCh38) Human (GRCh38)
Location 1:21510142-21510164 1:21510168-21510190
Sequence CCGCGAAGCCGAAGGAGCCTGCC CCCTTTAGGCTTTGCGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82} {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!