ID: 903189003_903189016

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 903189003 903189016
Species Human (GRCh38) Human (GRCh38)
Location 1:21646016-21646038 1:21646054-21646076
Sequence CCCCTGGGCCACCACTTCCCCTC CCTCATCTGTAAAATGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 512} {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!