ID: 903241792_903241800

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 903241792 903241800
Species Human (GRCh38) Human (GRCh38)
Location 1:21987580-21987602 1:21987611-21987633
Sequence CCATCTGGTTCTGCACCAAGTTT TGTGGTGACCTCCTGGGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 190} {0: 3, 1: 12, 2: 71, 3: 114, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!