ID: 903275610_903275617

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 903275610 903275617
Species Human (GRCh38) Human (GRCh38)
Location 1:22219416-22219438 1:22219464-22219486
Sequence CCTCTCTAGCCAGGCTGCCTCTC GCCTTTCCTCTTCTGCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 17, 2: 329, 3: 391, 4: 648} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!