ID: 903279946_903279959

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 903279946 903279959
Species Human (GRCh38) Human (GRCh38)
Location 1:22244759-22244781 1:22244806-22244828
Sequence CCCTCTGAGCCTTTGCTGCTGTG AACCAGGGGAGAAGGTGGGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!